Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pMx-MGT
(Plasmid #111810)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111810 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMx
  • Backbone size w/o insert (bp) 5871
  • Total vector size (bp) 8929
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Mef2c, Tbx5 and Gata4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4347
  • Entrez Gene
    Gata4 (a.k.a. Gata-4)
  • Entrez Gene
    Mef2c (a.k.a. 5430401D19Rik, 9930028G15Rik, Mef2)
  • Entrez Gene
    Tbx5
  • Promoter viral LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GACGGCATCGCAGCTTGGATACAC
  • 3′ sequencing primer ATAAAATCTTTTATTTTATC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMx-MGT was a gift from Li Qian (Addgene plasmid # 111810 ; http://n2t.net/addgene:111810 ; RRID:Addgene_111810)
  • For your References section:

    Stoichiometry of Gata4, Mef2c, and Tbx5 influences the efficiency and quality of induced cardiac myocyte reprogramming. Wang L, Liu Z, Yin C, Asfour H, Chen O, Li Y, Bursac N, Liu J, Qian L. Circ Res. 2015 Jan 16;116(2):237-44. doi: 10.1161/CIRCRESAHA.116.305547. Epub 2014 Nov 21. 10.1161/CIRCRESAHA.116.305547 PubMed 25416133