Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #111850)


Item Catalog # Description Quantity Price (USD)
Plasmid 111850 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3939
  • Total vector size (bp) 4500
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    KRAS G12V
  • Alt name
    Kirsten ras oncogene G12V
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    Changed Glycine 12 to Valine
  • Entrez Gene
    KRAS (a.k.a. C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras2)
  • Promoter T5
  • Tags / Fusion Proteins
    • 6xHis-tag (N terminal on backbone)
    • TEV protease cleavage sequence (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAATTGTGAGCGCTCACAA
  • 3′ sequencing primer GAACTGCCAGGCATCAAATAAAA
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDNA2.0 6H-TEV-KRAS G12V was a gift from Kenneth Westover (Addgene plasmid # 111850 ; ; RRID:Addgene_111850)
  • For your References section:

    Biochemical and Structural Analysis of Common Cancer-Associated KRAS Mutations. Hunter JC, Manandhar A, Carrasco MA, Gurbani D, Gondi S, Westover KD. Mol Cancer Res. 2015 Sep;13(9):1325-35. doi: 10.1158/1541-7786.MCR-15-0203. Epub 2015 Jun 2. 10.1158/1541-7786.MCR-15-0203 PubMed 26037647