pCB30
(Plasmid
#111910)
-
PurposeExpresses gRNA to target URA3 knockout locus and has KanMX marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 111910 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRS424Multi_KanM-Trp
-
Backbone manufacturerStanford Genome Technology Center
-
Modifications to backboneRemoved Leu marker and replaced with gRNA cassette
-
Vector typeBacterial Expression, Yeast Expression, CRISPR
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA cassette targeting URA3 knockout locus
-
gRNA/shRNA sequenceACCATCAAAGAAGGTTAATG
-
SpeciesS. cerevisiae (budding yeast)
- Promoter SNR52p
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer agcttgtctgtaagcgga
- 3′ sequencing primer cctatggaaaaacgccagAAT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB30 was a gift from Yi Tang (Addgene plasmid # 111910 ; http://n2t.net/addgene:111910 ; RRID:Addgene_111910)