-
PurposeExpresses TelN enzyme
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112011 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAA.3
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTelN
-
Insert Size (bp)2043
- Promoter T7
-
Tag
/ Fusion Protein
- strep and his (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTAGACTTCATTTCCTTCT
- 3′ sequencing primer TTATGTAAATAAGTTGGCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAA3.stelN was a gift from Stephen Harrison (Addgene plasmid # 112011 ; http://n2t.net/addgene:112011 ; RRID:Addgene_112011) -
For your References section:
Structure of the DASH/Dam1 complex shows its role at the yeast kinetochore-microtubule interface. Jenni S, Harrison SC. Science. 2018 May 4;360(6388):552-558. doi: 10.1126/science.aar6436. 10.1126/science.aar6436 PubMed 29724956