Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

CD4-C-BFP HDRT Source (pTR 176)
(Plasmid #112020)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112020 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD4-BFP HDRT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1355
  • Entrez Gene
    CD4 (a.k.a. CD4mut, IMD79, Leu-3, OKT4D, T4)

Cloning Information

  • Cloning method Gibson Cloning

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA sequence that can be used with this DNA template: CTGGCCTCGTGCCTCAAATG

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CD4-C-BFP HDRT Source (pTR 176) was a gift from Alexander Marson (Addgene plasmid # 112020 ; http://n2t.net/addgene:112020 ; RRID:Addgene_112020)
  • For your References section:

    Reprogramming human T cell function and specificity with non-viral genome targeting. Roth TL, Puig-Saus C, Yu R, Shifrut E, Carnevale J, Li PJ, Hiatt J, Saco J, Krystofinski P, Li H, Tobin V, Nguyen DN, Lee MR, Putnam AL, Ferris AL, Chen JW, Schickel JN, Pellerin L, Carmody D, Alkorta-Aranburu G, Del Gaudio D, Matsumoto H, Morell M, Mao Y, Cho M, Quadros RM, Gurumurthy CB, Smith B, Haugwitz M, Hughes SH, Weissman JS, Schumann K, Esensten JH, May AP, Ashworth A, Kupfer GM, Greeley SAW, Bacchetta R, Meffre E, Roncarolo MG, Romberg N, Herold KC, Ribas A, Leonetti MD, Marson A. Nature. 2018 Jul 11. pii: 10.1038/s41586-018-0326-5. doi: 10.1038/s41586-018-0326-5. 10.1038/s41586-018-0326-5 PubMed 29995861