pOmpT
(Plasmid
#112123)
-
PurposeBacterial expression outer membrane protein T (OmpT), wild type
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112123 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET11A
- Backbone size w/o insert (bp) 5636
- Total vector size (bp) 6530
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsExpressed protein ends up in inclusion bodies
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOmpT
-
Alt nameouter membrane protease T
-
SpeciesE. coli
-
Insert Size (bp)894
-
MutationN-terminal signal sequence not included and replaced with Methionine.
-
GenBank IDNC_000913.3
-
Entrez GeneompT (a.k.a. b0565, ECK0557)
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site nde1 (not destroyed)
- 3′ cloning site bamh1 (not destroyed)
- 5′ sequencing primer GCTACATATGTCTACCGAGACTTTATCG or T7
- 3′ sequencing primer GGCGGATCCTTAAAATGTGTACTTAAGACCAGCAG or T7 terminal (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOmpT was a gift from Karen Fleming (Addgene plasmid # 112123 ; http://n2t.net/addgene:112123 ; RRID:Addgene_112123) -
For your References section:
Beta-barrel proteins that reside in the Escherichia coli outer membrane in vivo demonstrate varied folding behavior in vitro. Burgess NK, Dao TP, Stanley AM, Fleming KG. J Biol Chem. 2008 Sep 26;283(39):26748-58. doi: 10.1074/jbc.M802754200. Epub 2008 Jul 19. 10.1074/jbc.M802754200 PubMed 18641391