pOmpT
(Plasmid #112123)

• Purpose: Bacterial expression outer membrane protein T (OmpT), wild type
• Depositing Lab: Karen Fleming
• Publication: Burgess et al J Biol Chem. 2008 Sep 26;283(39):26748-58. doi: 10.1074/jbc.M802754200. Epub 2008 Jul 19.

Backbone

• Vector backbone: pET11A
• Backbone size w/o insert (bp): 5636
• Total vector size (bp): 6530
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Expressed protein ends up in inclusion bodies
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: OmpT
• Alt name: outer membrane protease T
• Species: E. coli
• Insert Size (bp): 894
• Mutation: N-terminal signal sequence not included and replaced with Methionine.
• GenBank ID: NC_000913.3
• Entrez Gene: ompT (a.k.a. b0565, ECK0557)
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: nde1 (not destroyed)
• 3′ cloning site: bamh1 (not destroyed)
• 5′ sequencing primer: GCTACATATGTCTACCGAGACTTTATCG or T7
• 3′ sequencing primer: GGCGGATCCTTAAAATGTGTACTTAAGACCAGCAG or T7 terminal

Resource Information

• Supplemental Documents:
  • pET11a-OmpT-1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry