pET28-OmpT
(Plasmid
#68862)
-
Purposeconstruct for expression of OmpT protease in the pET28a plasmid using the restriction sites NcoI and EcoRI.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68862 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 6000
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOmpT
-
Alt nameProtease 7
-
Alt nameOmptin Outer membrane protein 3B
-
Alt nameProtease A, Protease VII
-
GenBank IDNC_000913.3
-
Entrez GeneompT (a.k.a. b0565, ECK0557)
-
Tag
/ Fusion Protein
- 6xHis (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATTAATCCATGGCTTC TCGAGACTTTATCGTTTA
- 3′ sequencing primer ACTCGGGAATTCTT AAAAGTGTACTTAAGACCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byCong Wu
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28-OmpT was a gift from Neil Kelleher (Addgene plasmid # 68862 ; http://n2t.net/addgene:68862 ; RRID:Addgene_68862) -
For your References section:
A protease for 'middle-down' proteomics. Wu C, Tran JC, Zamdborg L, Durbin KR, Li M, Ahlf DR, Early BP, Thomas PM, Sweedler JV, Kelleher NL. Nat Methods. 2012 Jun 17;9(8):822-4. doi: 10.1038/nmeth.2074. 10.1038/nmeth.2074 PubMed 22706673