Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLL4 sgRNA(MS2)-MS2-hA3a
(Plasmid #112130)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112130 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Zhang lab (Addgene plasmid #42230)
  • Backbone size w/o insert (bp) 7184
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Apobec3a
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Entrez Gene
    APOBEC3A (a.k.a. A3A, ARP3, PHRBN, bK150C2.1)
  • Promoter hU6,CBh

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CATCGCCGCTAACTCAGGTAT
  • 3′ sequencing primer GGGAGGGGCAAACAACAGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL4 sgRNA(MS2)-MS2-hA3a was a gift from Fei-Long Meng (Addgene plasmid # 112130 ; http://n2t.net/addgene:112130 ; RRID:Addgene_112130)
  • For your References section:

    Intrinsic Nucleotide Preference of Diversifying Base Editors Guides Antibody Ex Vivo Affinity Maturation. Liu LD, Huang M, Dai P, Liu T, Fan S, Cheng X, Zhao Y, Yeap LS, Meng FL. Cell Rep. 2018 Oct 23;25(4):884-892.e3. doi: 10.1016/j.celrep.2018.09.090. 10.1016/j.celrep.2018.09.090 PubMed 30355495