pcDNA3.1 SP-His-mCherry-HRP-VhHGFP
(Plasmid
#112157)
-
PurposeExpression and secretion of anti-GFP FLIPPER-bodies, small protein probes for correlated microscopy. FLIPPER-bodies are the fusion of a nanobody with a fluorescent protein and a peroxidase.
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112157 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5371
- Total vector size (bp) 7528
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-GFP FLIPPER-body
-
SpeciesSynthetic
-
Insert Size (bp)2157
- Promoter CMV
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- Thrombin cleavage site (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGGA
- 3′ sequencing primer TGGCAACTAGAAGGCACAGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bymCherry was directly derived from the Roger Tsien lab (Shaner et al. 2004) and is available via Addgene. Nanobody against GFP was from Addgene. HRP was amplified from FLIPPER (Kuipers et al. 2015), the original cDNA was provided by R.S. Lewis (Luik et al. 2006).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 SP-His-mCherry-HRP-VhHGFP was a gift from Ben Giepmans (Addgene plasmid # 112157 ; http://n2t.net/addgene:112157 ; RRID:Addgene_112157) -
For your References section:
A small protein probe for correlated microscopy of endogenous proteins. de Beer MA, Kuipers J, van Bergen En Henegouwen PMP, Giepmans BNG. Histochem Cell Biol. 2018 Mar;149(3):261-268. doi: 10.1007/s00418-018-1632-6. Epub 2018 Jan 11. 10.1007/s00418-018-1632-6 PubMed 29327239