Skip to main content

pcDNA3.1 SP-His-mCherry-HRP-VhHGFP
(Plasmid #112157)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112157 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1
  • Backbone size w/o insert (bp) 5371
  • Total vector size (bp) 7528
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    anti-GFP FLIPPER-body
  • Species
    Synthetic
  • Insert Size (bp)
    2157
  • Promoter CMV
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Thrombin cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGGA
  • 3′ sequencing primer TGGCAACTAGAAGGCACAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mCherry was directly derived from the Roger Tsien lab (Shaner et al. 2004) and is available via Addgene. Nanobody against GFP was from Addgene. HRP was amplified from FLIPPER (Kuipers et al. 2015), the original cDNA was provided by R.S. Lewis (Luik et al. 2006).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 SP-His-mCherry-HRP-VhHGFP was a gift from Ben Giepmans (Addgene plasmid # 112157 ; http://n2t.net/addgene:112157 ; RRID:Addgene_112157)
  • For your References section:

    A small protein probe for correlated microscopy of endogenous proteins. de Beer MA, Kuipers J, van Bergen En Henegouwen PMP, Giepmans BNG. Histochem Cell Biol. 2018 Mar;149(3):261-268. doi: 10.1007/s00418-018-1632-6. Epub 2018 Jan 11. 10.1007/s00418-018-1632-6 PubMed 29327239