Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3.1 SP-His-mCherry-HRP-VhHGFP
(Plasmid #112157)


Item Catalog # Description Quantity Price (USD)
Plasmid 112157 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5371
  • Total vector size (bp) 7528
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    anti-GFP FLIPPER-body
  • Species
  • Insert Size (bp)
  • Promoter CMV
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Thrombin cleavage site (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGGA
  • 3′ sequencing primer TGGCAACTAGAAGGCACAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mCherry was directly derived from the Roger Tsien lab (Shaner et al. 2004) and is available via Addgene. Nanobody against GFP was from Addgene. HRP was amplified from FLIPPER (Kuipers et al. 2015), the original cDNA was provided by R.S. Lewis (Luik et al. 2006).
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1 SP-His-mCherry-HRP-VhHGFP was a gift from Ben Giepmans (Addgene plasmid # 112157 ; ; RRID:Addgene_112157)