Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBS-I-Sce1-eno2:Tau-IRES-egfp
(Plasmid #112205)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112205 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBlueScript-ISce1
  • Total vector size (bp) 16000
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    MAPT
  • Alt name
    Tau
  • Species
    H. sapiens (human)
  • Entrez Gene
    MAPT (a.k.a. DDPAC, FTDP-17, MAPTL, MSTD, MTBT1, MTBT2, PPND, PPP1R103, TAU, Tau-PHF6, tau-40)
  • Promoter eno2 from zebrafish
  • Tag / Fusion Protein
    • eno2 exon 2 translational fusion, ires-egfp at c terminal

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TGGCTTTGCTCTTATCCAAT
  • 3′ sequencing primer TACAAATGTGGTATGGCTGA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    MAPT cDNA from Matt Farrer at Mayo Jacksonville

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBS-I-Sce1-eno2:Tau-IRES-egfp was a gift from Edward Burton (Addgene plasmid # 112205 ; http://n2t.net/addgene:112205 ; RRID:Addgene_112205)
  • For your References section:

    Generation of a transgenic zebrafish model of Tauopathy using a novel promoter element derived from the zebrafish eno2 gene. Bai Q, Garver JA, Hukriede NA, Burton EA. Nucleic Acids Res. 2007;35(19):6501-16. Epub 2007 Sep 25. 10.1093/nar/gkm608 PubMed 17897967