pAGM4723:Ble:Cas9
(Plasmid
#112208)
-
PurposeGolden Gate Level 2 construct encoding Cas9-YFP, Zeocin resistance.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112208 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAGM4723-Del
-
Vector typeCRISPR ; Diatom, Phaeodactylum
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)4860
-
MutationPhaeodactylum Fcp promoter
- Promoter Phaeodactylum Fcp
-
Tag
/ Fusion Protein
- YFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer cattacggacgagtacaaggtg (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSheBle
-
Alt nameBleomycin resistance protein
-
Insert Size (bp)857
- Promoter Phaeodactylum Fcp
-
Tag
/ Fusion Protein
- Phaeodactylum fcp promoter and terminator
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer gagACATACCTTCAGCGTCGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bypPha-TI plasmid, described in Zaslavskaia L, Lippmeier C, Kroth P. Grossman A, Apt Kirk. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. Was domesticated by removing and BpiI sites through site directed mutagenesis from the FCP promoter and terminator, was then inserted into an L1 pICH47732 vector. Cas9:YFP described in Hopes A, Nekrasov V, Kamoun S, Mock T. Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was assembled using Golden Gate Cloning.
Contains Zeocin resistance and Cas 9, for Phaeodactylum transformation. Can be used with sgRNA's on a separate plasmid or as a control.
Plasmid was construct according to Hopes 2016 (Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGM4723:Ble:Cas9 was a gift from Thomas Mock (Addgene plasmid # 112208 ; http://n2t.net/addgene:112208 ; RRID:Addgene_112208)