pZNF445.1.0-gDNA
(Plasmid
#112428)
-
PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF445
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerZhang lab (Addgene plasmid ID: 42230)
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZNF445
-
gRNA/shRNA sequenceACCATATTAGAGATTAGCCT GGG
-
SpeciesH. sapiens (human)
-
Entrez GeneZNF445 (a.k.a. ZNF168, ZKSCAN15, MGC126535)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3') (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA sequence listed includes 20 nucleotide target sequence, followed by the uncloned PAM sequence. The PAM sequence is not present in the plasmid. Use with plasmid pZNF445-donor.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZNF445.1.0-gDNA was a gift from Kevin White (Addgene plasmid # 112428 ; http://n2t.net/addgene:112428 ; RRID:Addgene_112428)