Skip to main content

pDEAF1.2.1-gDNA
(Plasmid #112449)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112449 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pX462 v2.0
  • Backbone manufacturer
    Zhang lab (Addgene plasmid ID: 62987)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DEAF1
  • gRNA/shRNA sequence
    CCACGTGGACTTCGTCTGCC TGG
  • Species
    H. sapiens (human)
  • Entrez Gene
    DEAF1 (a.k.a. MRD24, NUDR, SPN, ZMYND5)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer hU6-F (5'-GAGGGCCTATTTCCCATGATT-3')
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA sequence listed includes 20 nucleotide target sequence, followed by the uncloned PAM sequence. The PAM sequence is not present in the plasmid. This is a nickase guide and must be used with the additional nickase plasmid pDEAF1.2.2-gDNA and donor plasmid pDEAF1-donor.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEAF1.2.1-gDNA was a gift from Kevin White (Addgene plasmid # 112449 ; http://n2t.net/addgene:112449 ; RRID:Addgene_112449)