CLYBL hOPM
(Plasmid
#112499)
-
PurposeHomologous recombination vector for dox-inducible overexpression of OTX2, PAX6, and MITF in CLYBL locus
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112499 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneF8 CLYBL
- Backbone size w/o insert (bp) 10571
- Total vector size (bp) 14459
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCTCGTTTAGTGAACCGTCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CLYBL hOPM was a gift from Bruce Conklin (Addgene plasmid # 112499 ; http://n2t.net/addgene:112499 ; RRID:Addgene_112499)