Skip to main content

pLBH547_Tet-Cas14b2Locus
(Plasmid #112504)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112504 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    p15A
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas14b2
  • Insert Size (bp)
    2211
  • Promoter Tet

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gtgccgatcaacgtAtcattttcg
  • 3′ sequencing primer acgcagaaaggcccacccgaag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLBH547_Tet-Cas14b2Locus was a gift from Jennifer Doudna (Addgene plasmid # 112504 ; http://n2t.net/addgene:112504 ; RRID:Addgene_112504)
  • For your References section:

    Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Harrington LB, Burstein D, Chen JS, Paez-Espino D, Ma E, Witte IP, Cofsky JC, Kyrpides NC, Banfield JF, Doudna JA. Science. 2018 Oct 18. pii: science.aav4294. doi: 10.1126/science.aav4294. 10.1126/science.aav4294 PubMed 30337455