pCMV-BE3-FNLS(RA)
(Plasmid
#112671)
-
PurposeCMV expression vector for BE3-FNLS construct (codon optimized)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBE3-FNLS
-
Alt nameFNLS
-
SpeciesSynthetic
-
Insert Size (bp)5250
-
MutationNLS sequence at the N-terminus and D10A
- Promoter CMV
-
Tag
/ Fusion Protein
- 3x FLAG (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGAAACAGCTATGACCATG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-BE3-FNLS(RA) was a gift from Lukas Dow (Addgene plasmid # 112671 ; http://n2t.net/addgene:112671 ; RRID:Addgene_112671) -
For your References section:
Optimized base editors enable efficient editing in cells, organoids and mice. Zafra MP, Schatoff EM, Katti A, Foronda M, Breinig M, Schweitzer AY, Simon A, Han T, Goswami S, Montgomery E, Thibado J, Kastenhuber ER, Sanchez-Rivera FJ, Shi J, Vakoc CR, Lowe SW, Tschaharganeh DF, Dow LE. Nat Biotechnol. 2018 Jul 3. pii: nbt.4194. doi: 10.1038/nbt.4194. 10.1038/nbt.4194 PubMed 29969439