Skip to main content

pcDNA4/TO-bio-myc-NES-EGFP
(Plasmid #112712)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112712 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA4/TO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5078
  • Total vector size (bp) 6185
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • Alt name
    Enhanced green fluorescence protein
  • Species
    Aequorea victoria
  • Insert Size (bp)
    1107
  • Mutation
    Nucleotide sequence optimized for synthetic gene production
  • Promoter CMV with Tet repressor binding sites
  • Tags / Fusion Proteins
    • biotinylation signal peptide (Tagwerker et al. 2006 Mol Cell Proteomics, 10.1074/mcp.M500368-MCP200) (N terminal on insert)
    • myc tag (N terminal on insert)
    • HIV Rev nuclear localization signal (NES) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer pcDNA4TO-CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer pcDNA4TO-R (AGCATGCCTGCTATTGTCTTCCCA)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Insert was synthesized as a gBlock by Integrated DNA Technologies

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The N-terminal tag sequence of this insert is exactly the same as in pcDNA4/TO-bio-myc-cCE, thus providing a specificity control for pulldown assays.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA4/TO-bio-myc-NES-EGFP was a gift from Daniel Schoenberg (Addgene plasmid # 112712 ; http://n2t.net/addgene:112712 ; RRID:Addgene_112712)
  • For your References section:

    RNA-binding proteins and heat-shock protein 90 are constituents of the cytoplasmic capping enzyme interactome. Trotman JB, Agana BA, Giltmier AJ, Wysocki VH, Schoenberg DR. J Biol Chem. 2018 Oct 26;293(43):16596-16607. doi: 10.1074/jbc.RA118.004973. Epub 2018 Aug 30. 10.1074/jbc.RA118.004973 PubMed 30166341