-
PurposeExpresses YFP-KRAS4B fusion protein used for FRET studies in eukaryotic cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerThermoFisher Scientific
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYFP-KRAS4B
-
Alt nameenhanced yellow fluorescent protein-Kirsten ras oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1317
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCCTG
- 3′ sequencing primer BGH Reverse: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-YFP-KRAS4B was a gift from Kenneth Westover (Addgene plasmid # 112718 ; http://n2t.net/addgene:112718 ; RRID:Addgene_112718) -
For your References section:
KRAS Dimerization Impacts MEK Inhibitor Sensitivity and Oncogenic Activity of Mutant KRAS. Ambrogio C, Kohler J, Zhou ZW, Wang H, Paranal R, Li J, Capelletti M, Caffarra C, Li S, Lv Q, Gondi S, Hunter JC, Lu J, Chiarle R, Santamaria D, Westover KD, Janne PA. Cell. 2018 Feb 8;172(4):857-868.e15. doi: 10.1016/j.cell.2017.12.020. Epub 2018 Jan 11. 10.1016/j.cell.2017.12.020 PubMed 29336889