His6-SUMO-pET28a-EfaCas1
(Plasmid
#112793)
-
PurposeTo express enterococcus faecalis Cas1 protein in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112793 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneHis6-SUMO-pET28a
- Backbone size w/o insert (bp) 5800
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEfaCas1
-
SpeciesSynthetic
-
Tag
/ Fusion Protein
- His6-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site cgcGGATCCATGGGCTGGCGAACGGTAGTGG (destroyed during cloning)
- 3′ cloning site AAGGAAAAAAGCGGCCGCTCATATCCCAAACTCTGGAACT (destroyed during cloning)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His6-SUMO-pET28a-EfaCas1 was a gift from Ailong Ke (Addgene plasmid # 112793 ; http://n2t.net/addgene:112793 ; RRID:Addgene_112793) -
For your References section:
How type II CRISPR-Cas establish immunity through Cas1-Cas2-mediated spacer integration. Xiao Y, Ng S, Nam KH, Ke A. Nature. 2017 Oct 5;550(7674):137-141. doi: 10.1038/nature24020. Epub 2017 Sep 4. 10.1038/nature24020 PubMed 28869593