pCTD26-S>A10-17
(Plasmid
#112826)
-
PurposepSMF2 with all S to A mutations in only repeats 10-17.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 112826 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJMD2
- Backbone size w/o insert (bp) 5345
- Total vector size (bp) 5957
-
Vector typeYeast Expression
-
Selectable markersGentamicin, LEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRPB1
-
Alt nameRPO21
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)5200
-
MutationpSMF2 with all S to A mutations in only repeats 10-17.
-
Entrez GeneRPO21 (a.k.a. YDL140C, RPB1, RPB220, SIT1, SUA8)
- Promoter Native promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xma1 (not destroyed)
- 3′ cloning site Sac1 (not destroyed)
- 5′ sequencing primer GATCGATGAGGAGTCACTGG
- 3′ sequencing primer TTTACTAGCGCCGTTGGTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCTD26-S>A10-17 was a gift from Stephen Fuchs (Addgene plasmid # 112826 ; http://n2t.net/addgene:112826 ; RRID:Addgene_112826) -
For your References section:
Repeat-Specific Functions for the C-Terminal Domain of RNA Polymerase II in Budding Yeast. Babokhov M, Mosaheb MM, Baker RW, Fuchs SM. G3 (Bethesda). 2018 May 4;8(5):1593-1601. doi: 10.1534/g3.118.200086. 10.1534/g3.118.200086 PubMed 29523636