rat APOBEC1
(Plasmid
#112858)
-
Purposeplasmid for expression of rat APOBEC1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-C3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4727
- Total vector size (bp) 4627
-
Modifications to backbonethe EGFP cds has been removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAPOBEC1
-
Alt nameapolipoprotein B mRNA editing enzyme, catalytic polypeptide 1
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)603
-
GenBank IDNM_012907
-
Entrez GeneApobec1 (a.k.a. REPR, apobec-1)
- Promoter CMV promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (unknown if destroyed)
- 5′ sequencing primer CGTGTACGGTGGGAGGTCTA
- 3′ sequencing primer TTCAGGTTCAGGGGGAGGTG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rat APOBEC1 was a gift from Silvestro Conticello (Addgene plasmid # 112858 ; http://n2t.net/addgene:112858 ; RRID:Addgene_112858) -
For your References section:
Flow-cytometric visualization of C>U mRNA editing reveals the dynamics of the process in live cells. Severi F, Conticello SG. RNA Biol. 2015;12(4):389-97. doi: 10.1080/15476286.2015.1026033. 10.1080/15476286.2015.1026033 PubMed 25806564