Skip to main content

pR_LG lenti-(empty)-del-CTS
(Plasmid #112895)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112895 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUGW
  • Backbone size (bp) 6976
  • Modifications to backbone
    dinucleotide substitution in 5' LTR to render virus non-integrating
  • Vector type
    Lentiviral
  • Promoter none

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tacatcaatgggcgtggata
  • 3′ sequencing primer atcgtttcagacccacctcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pR_LG is a non-integrating lentiviral vector derived from lentiCas9-Blast by creating a 2 bp substitution in the 5' LTR and deleting the transgene and part of cPPT (deletion spans 5.9 kb from cPPT to U3PPT).

Please visit https://doi.org/10.1101/262121 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pR_LG lenti-(empty)-del-CTS was a gift from Paul Blainey (Addgene plasmid # 112895 ; http://n2t.net/addgene:112895 ; RRID:Addgene_112895)
  • For your References section:

    Lentiviral co-packaging mitigates the effects of intermolecular recombination and multiple integrations in pooled genetic screens. Feldman D, Singh A, Garrity AJ, Blainey PC. bioRxiv 262121 10.1101/262121