-
Purpose(Empty Backbone) Non-integrating lentiviral co-packaging plasmid designed to reduce multiple integrations and recombination during transduction of nucleic acid libraries
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
- Backbone size (bp) 6976
-
Modifications to backbonedinucleotide substitution in 5' LTR to render virus non-integrating
-
Vector typeLentiviral
- Promoter none
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tacatcaatgggcgtggata
- 3′ sequencing primer atcgtttcagacccacctcc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pR_LG is a non-integrating lentiviral vector derived from lentiCas9-Blast by creating a 2 bp substitution in the 5' LTR and deleting the transgene and part of cPPT (deletion spans 5.9 kb from cPPT to U3PPT).
Please visit https://doi.org/10.1101/262121 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pR_LG lenti-(empty)-del-CTS was a gift from Paul Blainey (Addgene plasmid # 112895 ; http://n2t.net/addgene:112895 ; RRID:Addgene_112895) -
For your References section:
Lentiviral co-packaging mitigates the effects of intermolecular recombination and multiple integrations in pooled genetic screens. Feldman D, Singh A, Garrity AJ, Blainey PC. bioRxiv 262121 10.1101/262121