-
PurposeRetrovirus expressing mRFP1 with BBSI cloning sites for sgRNA
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV
- Backbone size w/o insert (bp) 6302
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemRFP1
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ataagtgcagtagtcgccgt
- 3′ sequencing primer GCTTTAAATTTGCGCATGCTA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
retro-gRNA-mRFP1 was a gift from Christophe Benoist & Diane Mathis (Addgene plasmid # 112914 ; http://n2t.net/addgene:112914 ; RRID:Addgene_112914) -
For your References section:
Identification and validation of a tumor-infiltrating Treg transcriptional signature conserved across species and tumor types. Magnuson AM, Kiner E, Ergun A, Park JS, Asinovski N, Ortiz-Lopez A, Kilcoyne A, Paoluzzi-Tomada E, Weissleder R, Mathis D, Benoist C. Proc Natl Acad Sci U S A. 2018 Nov 6;115(45):E10672-E10681. doi: 10.1073/pnas.1810580115. Epub 2018 Oct 22. 10.1073/pnas.1810580115 PubMed 30348759