Skip to main content
Addgene

retro-gRNA-mRFP1
(Plasmid #112914)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 112914 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MSCV
  • Backbone size w/o insert (bp) 6302
  • Vector type
    Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRFP1
  • Promoter EF1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagtgcagtagtcgccgt
  • 3′ sequencing primer GCTTTAAATTTGCGCATGCTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    retro-gRNA-mRFP1 was a gift from Christophe Benoist & Diane Mathis (Addgene plasmid # 112914)
  • For your References section:

    Identification and validation of a tumor-infiltrating Treg transcriptional signature conserved across species and tumor types. Magnuson AM, Kiner E, Ergun A, Park JS, Asinovski N, Ortiz-Lopez A, Kilcoyne A, Paoluzzi-Tomada E, Weissleder R, Mathis D, Benoist C. Proc Natl Acad Sci U S A. 2018 Nov 6;115(45):E10672-E10681. doi: 10.1073/pnas.1810580115. Epub 2018 Oct 22. 10.1073/pnas.1810580115 PubMed 30348759