Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLX-sgRNA-BfuAI-2k
(Plasmid #112915)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 112915 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLX-sgRNA
  • Backbone size (bp) 7500
  • Modifications to backbone
    Modified to enable sgRNA insertion after BfuAI digestion. Also modified to include a 2kb stuffer sequence for easier gel purification of the fully digested vector.
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer cgggtttattacagggacagcag
  • 3′ sequencing primer taccagtcaatctttcacaaattttgt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX-sgRNA-BfuAI-2k was a gift from Ren-Jang Lin (Addgene plasmid # 112915 ; http://n2t.net/addgene:112915 ; RRID:Addgene_112915)
  • For your References section:

    MicroRNA-focused CRISPR-Cas9 Library Screen Reveals Fitness-Associated miRNAs. Kurata JS, Lin RJ. RNA. 2018 May 2. pii: rna.066282.118. doi: 10.1261/rna.066282.118. 10.1261/rna.066282.118 PubMed 29720387