Skip to main content

pOTTC1079 - pAAV TH gRNA A EF1a EGFP
(Plasmid #113159)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113159 Standard format: Plasmid sent in bacteria as agar stab 1 $89

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pOTTC407
  • Backbone manufacturer
    NIDA OTTC
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 6562
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    gRNA for rat TH
  • gRNA/shRNA sequence
    ACGGCCCTTCTGAAGCCCTT
  • Species
    R. norvegicus (rat)
  • Promoter mU6

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1079 - pAAV TH gRNA A EF1a EGFP was a gift from Brandon Harvey (Addgene plasmid # 113159 ; http://n2t.net/addgene:113159 ; RRID:Addgene_113159)
  • For your References section:

    Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150