Skip to main content

pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
(Plasmid #113162)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113162 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pZDrRosa26
  • Backbone manufacturer
    Sigma
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 12714
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SpCas9
  • Alt name
    S. pyogenes Cas9 nuclease
  • Alt name
    Cas9
  • Species
    Synthetic
  • Insert Size (bp)
    4200
  • Mutation
    D10A
  • Promoter CAG
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TCTCGTTGCTGAAGATCTCTTGCAG
  • 3′ sequencing primer CAGGCCGAGAATATCATCCACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: Addgene NGS unable to fully resolve the CAG promoter sequence. Please refer to the depositor's provided sequence for that section of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR was a gift from Brandon Harvey (Addgene plasmid # 113162 ; http://n2t.net/addgene:113162 ; RRID:Addgene_113162)
  • For your References section:

    Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150