pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR
(Plasmid
#113162)
-
PurposeA donor plasmid with homologous arms matching rat Rosa26 and expressing a Cre-dependent FLAG-tagged SpCas9n and a NeoR selectable marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113162 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepZDrRosa26
-
Backbone manufacturerSigma
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 12714
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
-
Alt nameS. pyogenes Cas9 nuclease
-
Alt nameCas9
-
SpeciesSynthetic
-
Insert Size (bp)4200
-
MutationD10A
- Promoter CAG
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCTCGTTGCTGAAGATCTCTTGCAG
- 3′ sequencing primer CAGGCCGAGAATATCATCCACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe insert was amplified from PX461, addgene 48140
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: Addgene NGS unable to fully resolve the CAG promoter sequence. Please refer to the depositor's provided sequence for that section of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOTTC1076 - prRosa26v1 LSL FLAG-SpCas9n NeoR was a gift from Brandon Harvey (Addgene plasmid # 113162 ; http://n2t.net/addgene:113162 ; RRID:Addgene_113162) -
For your References section:
Neuron-Specific Genome Modification in the Adult Rat Brain Using CRISPR-Cas9 Transgenic Rats. Back S, Necarsulmer J, Whitaker LR, Coke LM, Koivula P, Heathward EJ, Fortuno LV, Zhang Y, Yeh CG, Baldwin HA, Spencer MD, Mejias-Aponte CA, Pickel J, Hoffman AF, Spivak CE, Lupica CR, Underhill SM, Amara SG, Domanskyi A, Anttila JE, Airavaara M, Hope BT, Hamra FK, Richie CT, Harvey BK. Neuron. 2019 Feb 8. pii: S0896-6273(19)30062-5. doi: 10.1016/j.neuron.2019.01.035. 10.1016/j.neuron.2019.01.035 PubMed 30792150