Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #61408)


Item Catalog # Description Quantity Price (USD)
Plasmid 61408 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 14500
  • Total vector size (bp) 20541
  • Vector type
    Mammalian Expression, Mouse Targeting, Cre/Lox, CRISPR
  • Selectable markers
    Neomycin (select with G418) ; DTA

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
  • Species
    Synthetic; streptococcus pyogenes
  • Insert Size (bp)
  • Mutation
    human codon optimized
  • Promoter CAG
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert)
    • P2A (C terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer atgtctggatccccatcaagc
  • 3′ sequencing primer CTGCTTGTCGGCCATGATATAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Insert Size (bp)
  • Promoter CAG

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGTCTCAGCTGGGAGGCGAC
  • 3′ sequencing primer gtatccacatagcgtaaaaggagc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LSL-Cas9-Rosa26TV was a gift from Feng Zhang (Addgene plasmid # 61408)
  • For your References section:

    CRISPR-Cas9 Knockin Mice for Genome Editing and Cancer Modeling. Platt RJ, Chen S, Zhou Y, Yim MJ, Swiech L, Kempton HR, Dahlman JE, Parnas O, Eisenhaure TM, Jovanovic M, Graham DB, Jhunjhunwala S, Heidenreich M, Xavier RJ, Langer R, Anderson DG, Hacohen N, Regev A, Feng G, Sharp PA, Zhang F. Cell. 2014 Sep 24. pii: S0092-8674(14)01163-5. doi: 10.1016/j.cell.2014.09.014. 10.1016/j.cell.2014.09.014 PubMed 25263330