Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAW-SpyCas1
(Plasmid #113248)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113248 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET16bMBP
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7734
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    S. pyogenes Cas1
  • Alt name
    SpyCas1
  • Species
    S. pyogenes
  • Insert Size (bp)
    870
  • GenBank ID
    NC_002737.2
  • Promoter T7
  • Tag / Fusion Protein
    • 6xHis-MBP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CAGCGGTCGTCAGACTGTCG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    James Nuñez, Doudna Lab

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAW-SpyCas1 was a gift from Jennifer Doudna (Addgene plasmid # 113248 ; http://n2t.net/addgene:113248 ; RRID:Addgene_113248)
  • For your References section:

    Protecting genome integrity during CRISPR immune adaptation. Wright AV, Doudna JA. Nat Struct Mol Biol. 2016 Oct;23(10):876-883. doi: 10.1038/nsmb.3289. Epub 2016 Sep 5. 10.1038/nsmb.3289 PubMed 27595346