pClodAcytCh-GFP-P4M
(Plasmid
#113346)
-
PurposeBacterial expression of Cherry and GFP-SidM-P4M domain (2 copies)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113346 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepClodA
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameCherry
-
SpeciesSynthetic
- Promoter proD
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGTCAGGCAACTATGGATGA
- 3′ sequencing primer gtgtccgcagcgctAGATCT
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGFP-SidM-P4M domain (2 copies of P4M in tandem)
- Promoter ProD
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer tgctgtgctctgcgaaagccagt
- 3′ sequencing primer CACCTGACGTCTAAGAAACCAT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Tamas Balla of the Program for Developmental Neuroscience at NIH, kindly provided the original plasmid with the GFP-P4M-SidMx2 containing plasmid as a reporter for PI4P localization(42). We obtained this last plasmid through Addgene (plasmid #51472).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pClodAcytCh-GFP-P4M was a gift from Sanford Simon (Addgene plasmid # 113346 ; http://n2t.net/addgene:113346 ; RRID:Addgene_113346) -
For your References section:
Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849