pcDNA3.1 PA-mCit-NL
(Plasmid
#113444)
-
PurposeProteinA-mCitrine-NanoLuc hybrid-fusion control expression vector (positive control)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6492
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProteinA-mCitrine-NanoLuc
-
Insert Size (bp)1620
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCAAATGGGCGGTAGGCGT
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1 PA-mCit-NL was a gift from Erich Wanker (Addgene plasmid # 113444 ; http://n2t.net/addgene:113444 ; RRID:Addgene_113444) -
For your References section:
LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244