Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pLenti GW-NL-myc
(Plasmid #113455)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113455 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    FUGW
  • Backbone manufacturer
    FUGW was a gift from David Baltimore (Addgene plasmid # 14883)
  • Backbone size (bp) 9955
  • Vector type
    Mammalian Expression, Lentiviral, Luciferase
  • Promoter hUbC
  • Tag / Fusion Protein
    • NanoLuc-cmyc (C terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer tgaagctccggttttgaact
  • 3′ sequencing primer ccccgagattctgaaacaaac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Viral Core Facility (VCF) of the Charité – Universitätsmedizin Berlin
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti GW-NL-myc was a gift from Erich Wanker (Addgene plasmid # 113455 ; http://n2t.net/addgene:113455 ; RRID:Addgene_113455)
  • For your References section:

    LuTHy: a double-readout bioluminescence-based two-hybrid technology for quantitative mapping of protein-protein interactions in mammalian cells. Trepte P, Kruse S, Kostova S, Hoffmann S, Buntru A, Tempelmeier A, Secker C, Diez L, Schulz A, Klockmeier K, Zenkner M, Golusik S, Rau K, Schnoegl S, Garner CC, Wanker EE. Mol Syst Biol. 2018 Jul 11;14(7):e8071. doi: 10.15252/msb.20178071. 10.15252/msb.20178071 PubMed 29997244