-
Purposeexpresses Cth SUMO protease in Escherichia coli
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET29b
-
Backbone manufacturerNovagen
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCth SUMO protease
-
SpeciesChaetomium thermophilum
-
Insert Size (bp)795
-
Mutationdeleted amino acids 1-934
-
GenBank IDXM_006690914.1
- Promoter T7
-
Tag
/ Fusion Protein
- 10-His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDB302 was a gift from Christopher Bahl (Addgene plasmid # 113673 ; http://n2t.net/addgene:113673 ; RRID:Addgene_113673) -
For your References section:
Discovery and engineering of enhanced SUMO protease enzymes. Lau YK, Baytshtok V, Howard TA, Fiala BM, Johnson JM, Carter LP, Baker D, Lima CD, Bahl CD. J Biol Chem. 2018 Aug 24;293(34):13224-13233. doi: 10.1074/jbc.RA118.004146. Epub 2018 Jul 5. 10.1074/jbc.RA118.004146 PubMed 29976752