-
PurposeExpress NIR-GECO1 preferentially in neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4557
- Total vector size (bp) 6111
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-NIR-GECO1
-
SpeciesSynthetic
-
Insert Size (bp)1554
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAGGAGTCGTGTCGTGCC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that discrepancies between sequencing results obtained by Addgene and the sequence provided by the depositor have been found. Sequences provided by depositing laboratories may be theoretical/predicted or based on Sanger/NGS sequencing results. The discrepancies found are not predicted to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-NES-NIR-GECO1 was a gift from Robert Campbell (Addgene plasmid # 113683 ; http://n2t.net/addgene:113683 ; RRID:Addgene_113683) -
For your References section:
A genetically encoded near-infrared fluorescent calcium ion indicator. Qian Y, Piatkevich KD, Mc Larney B, Abdelfattah AS, Mehta S, Murdock MH, Gottschalk S, Molina RS, Zhang W, Chen Y, Wu J, Drobizhev M, Hughes TE, Zhang J, Schreiter ER, Shoham S, Razansky D, Boyden ES, Campbell RE. Nat Methods. 2019 Feb;16(2):171-174. doi: 10.1038/s41592-018-0294-6. Epub 2019 Jan 21. 10.1038/s41592-018-0294-6 PubMed 30664778