AAV-CAG-FLInChR-mVenus
(Plasmid
#119298)
-
PurposeFLinChR is the fusion signal sequence and transmembrane (TM) domain of Neurexin 1B-delta to ChR2E123T/T159C for inversion ChR2 to an optogenetic inhibitor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 119298 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2-CAG-MSC-WPRE(Penn)
- Backbone size w/o insert (bp) 5012
- Total vector size (bp) 7154
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNx1BTM-FCS-ChR2ET/TC-mVenus
-
Alt nameFLInChR-mVenus
-
Insert Size (bp)2142
- Promoter CAG
-
Tag
/ Fusion Protein
- mVenus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHl (not destroyed)
- 3′ cloning site EcoRl (not destroyed)
- 5′ sequencing primer atccgccaccatgtaccaga
- 3′ sequencing primer aattcttacttgtacagctc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-FLInChR-mVenus was a gift from Alla Karpova (Addgene plasmid # 119298 ; http://n2t.net/addgene:119298 ; RRID:Addgene_119298) -
For your References section:
Expanding the Optogenetics Toolkit by Topological Inversion of Rhodopsins. Brown J, Behnam R, Coddington L, Tervo DGR, Martin K, Proskurin M, Kuleshova E, Park J, Phillips J, Bergs ACF, Gottschalk A, Dudman JT, Karpova AY. Cell. 2018 Oct 16. pii: S0092-8674(18)31238-8. doi: 10.1016/j.cell.2018.09.026. 10.1016/j.cell.2018.09.026 PubMed 30343901