-
PurposeExpress NIR-GECO1 preferentially in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4557
- Total vector size (bp) 6111
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNES-NIR-GECO1
-
SpeciesSynthetic
-
Insert Size (bp)1554
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAGGAGTCGTGTCGTGCC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that discrepancies between sequencing results obtained by Addgene and the sequence provided by the depositor have been found. Sequences provided by depositing laboratories may be theoretical/predicted or based on Sanger/NGS sequencing results. The discrepancies found are not predicted to impact plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-NES-NIR-GECO1 was a gift from Robert Campbell (Addgene plasmid # 113683 ; http://n2t.net/addgene:113683 ; RRID:Addgene_113683) -
For your References section:
A genetically encoded near-infrared fluorescent calcium ion indicator. Qian Y, Piatkevich KD, Mc Larney B, Abdelfattah AS, Mehta S, Murdock MH, Gottschalk S, Molina RS, Zhang W, Chen Y, Wu J, Drobizhev M, Hughes TE, Zhang J, Schreiter ER, Shoham S, Razansky D, Boyden ES, Campbell RE. Nat Methods. 2019 Feb;16(2):171-174. doi: 10.1038/s41592-018-0294-6. Epub 2019 Jan 21. 10.1038/s41592-018-0294-6 PubMed 30664778