pAAV-hSyn-NES-NIR-GECO1
(Plasmid #113683)

• Purpose: Express NIR-GECO1 preferentially in neurons
• Depositing Lab: Robert Campbell
• Publication: Qian et al Nat Methods. 2019 Feb;16(2):171-174. doi: 10.1038/s41592-018-0294-6. Epub 2019 Jan 21.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 4557
• Total vector size (bp): 6111
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: NES-NIR-GECO1
• Species: Synthetic
• Insert Size (bp): 1554
• Promoter: hSyn

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: GAGGAGTCGTGTCGTGCC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV NES-NIR-GECO1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry