pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA
(Plasmid
#113702)
-
PurposeDox-inducible H1 driven SaCas9 gRNA expression cassette with a gRNA targeting CREB. Followed by an EFS driven GFP-KASH in a separate reading frame.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 113702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $65 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerAlligent Technologies
- Total vector size (bp) 6299
-
Vector typeMouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSaCas9 gRNA Cassete
-
gRNA/shRNA sequenceGGAGCAGACAACCAGCAGAG
-
SpeciesSynthetic
-
Insert Size (bp)76
Gene/Insert 2
-
Gene/Insert nameGFP
-
gRNA/shRNA sequenceN/A
-
SpeciesSynthetic
-
Insert Size (bp)717
-
Tag
/ Fusion Protein
- KASH (C terminal on insert)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypX601-AAV-CMV::NLS-SaCas9-NLS-3xHA-bGHpA;U6::BsaI-sgRNA from Feng Zhang plasmid #61591.pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA from Jonathan Ploski, plasmid #82702.
-
Terms and Licenses
Depositor Comments
The H1TO promoter renders the gRNA inducible via the presence of Doxycycline. See: The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing. de Solis CA, Ho A, Holehonnur R, Ploski JE. Front Mol Neurosci. 2016 Aug 18;9:70. doi: 10.3389/fnmol.2016.00070. eCollection 2016. 10.3389/fnmol.2016.00070 PubMed 27587996
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEP325-pAAV-FullH1TO-SaCa9sgRNAi(CREB)-CMV-TetR-2A-EGFP-KASH-WPRE-shortPA was a gift from Jonathan Ploski (Addgene plasmid # 113702 ; http://n2t.net/addgene:113702 ; RRID:Addgene_113702) -
For your References section:
The Development of an AAV-Based CRISPR SaCas9 Genome Editing System That Can Be Delivered to Neurons in vivo and Regulated via Doxycycline and Cre-Recombinase. Kumar N, Stanford W, Aradhana CS, Abraham ND, Dao TJ, Thaseen S, Sairavi A, Gonzalez CU and Ploski JE.. Front. Mol. Neurosci. (2018) 13 10.3389/fnmol.2018.00413