pENTR-PpU6P-sgRNA-L1L2
(Plasmid
#113735)
-
PurposeGateway entry vector containing attL1 and attL2 sites, U6 promoter, BsaI sites for protospacer ligation, and sgRNA.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepDONR221-P1P2
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2538
-
Vector typeCRISPR ; Gateway Entry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePpU6P::sgRNA
-
gRNA/shRNA sequenceaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctat
-
Insert Size (bp)485
- Promoter P. patens U6 promoter
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer M13 Forward
- 3′ sequencing primer M13 Reverse
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR-PpU6P-sgRNA-L1L2 was a gift from Magdalena Bezanilla (Addgene plasmid # 113735 ; http://n2t.net/addgene:113735 ; RRID:Addgene_113735) -
For your References section:
Efficient and modular CRISPR-Cas9 vector system for Physcomitrella patens. Mallett DR, Chang M, Cheng X, Bezanilla M. Plant Direct. 2019 Sep 12;3(9):e00168. doi: 10.1002/pld3.168. eCollection 2019 Sep. 10.1002/pld3.168 PubMed 31523744