Skip to main content

MDH1-PGK-GFP_2.0
(Plasmid #11375)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11375 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MDH1-PGK-GFP 2.0
  • Backbone size (bp) 6963
  • Vector type
    Mammalian Expression, Retroviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer ggatcccaatatttgcatgtcgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MDH1-PGK-GFP_2.0 was a gift from Chang-Zheng Chen (Addgene plasmid # 11375 ; http://n2t.net/addgene:11375 ; RRID:Addgene_11375)
  • For your References section:

    MicroRNAs modulate hematopoietic lineage differentiation. Chen CZ, Li L, Lodish HF, Bartel DP. Science. 2004 Jan 2. 303(5654):83-6. 10.1126/science.1091903 PubMed 14657504