-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 16070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMDH1-PGK-GFP 2.0
- Backbone size w/o insert (bp) 6963
-
Vector typeMammalian Expression, Retroviral, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemicroRNA-10b
-
Alt namemiR-10b
-
SpeciesH. sapiens (human)
-
Insert Size (bp)315
-
Entrez GeneMIR10B (a.k.a. MIRN10B, hsa-mir-10b, miRNA10B, mir-10b)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer EGFP-C
- 3′ sequencing primer ggatcccaatatttgcatgtcgc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The miRNA gene was PCR-amplified from normal human genomic DNA and cloned into the MDH1-PGK-GFP 2.0 retroviral vector. It includes miR-10b stem-loop and ~100bp flanking sequences on both sides.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MDH1-PGK-GFP microRNA-10b was a gift from Bob Weinberg (Addgene plasmid # 16070 ; http://n2t.net/addgene:16070 ; RRID:Addgene_16070) -
For your References section:
Tumour invasion and metastasis initiated by microRNA-10b in breast cancer. Ma L, Teruya-Feldstein J, Weinberg RA. Nature. 2007 Oct 11. 449(7163):682-8. 10.1038/nature06174 PubMed 17898713