This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

aav-CAG-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid #113761)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113761 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stabl2 or Stabl3, 30C or 37C
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    tdNfsB(F124W)-mCherry
  • Alt name
    nfsb, eNTR
  • Species
    E. coli
  • Insert Size (bp)
    2109
  • Mutation
    F124W
  • Promoter CAG
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI/NheI (destroyed during cloning)
  • 5′ sequencing primer ggttcggcttctggcgtgtgacc
  • 3′ sequencing primer aaggcattaaagcagcgtatc
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    aav-CAG-tdNfsB(F124W)-mCherry (eNTR) was a gift from Luke Lavis (Addgene plasmid # 113761 ; http://n2t.net/addgene:113761 ; RRID:Addgene_113761)
  • For your References section:

    Cell-Specific Chemical Delivery Using a Selective Nitroreductase-Nitroaryl Pair. Gruber TD, Krishnamurthy C, Grimm JB, Tadross MR, Wysocki LM, Gartner ZJ, Lavis LD. ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524. 10.1021/acschembio.8b00524 PubMed 30111097