aav-CAG-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid
#113761)
-
PurposeAAV-mediated expression of bacterial tdNfsB-mCherry (eNTR) under the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 113761 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2
- Total vector size (bp) 6838
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStabl2 or Stabl3, 30C or 37C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdNfsB(F124W)-mCherry
-
Alt namenfsb, eNTR
-
SpeciesE. coli
-
Insert Size (bp)2109
-
MutationF124W
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI/NheI (destroyed during cloning)
- 5′ sequencing primer ggttcggcttctggcgtgtgacc
- 3′ sequencing primer aaggcattaaagcagcgtatc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aav-CAG-tdNfsB(F124W)-mCherry (eNTR) was a gift from Luke Lavis (Addgene plasmid # 113761 ; http://n2t.net/addgene:113761 ; RRID:Addgene_113761) -
For your References section:
Cell-Specific Chemical Delivery Using a Selective Nitroreductase-Nitroaryl Pair. Gruber TD, Krishnamurthy C, Grimm JB, Tadross MR, Wysocki LM, Gartner ZJ, Lavis LD. ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524. 10.1021/acschembio.8b00524 PubMed 30111097