Skip to main content

pYFP-NGAT(A193T,N194Y)
(Plasmid #11388)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 11388 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEYFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4731
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    golgi associated, gamma adaptin ear containing, ARF binding protein 1
  • Alt name
    GGA1
  • Alt name
    NGAT
  • Alt name
    hook
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    141
  • Mutation
    Changed Alanine 193 to Threonine, and Asparagine 194 to Tyrosine
  • GenBank ID
    NM_013365
  • Entrez Gene
    GGA1
  • Tag / Fusion Protein
    • YFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCTGAGCAAAGACCCCAACGAGAA
  • 3′ sequencing primer CAGGGGGAGGTGTGGGAGGTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hGGA1 cDNA was a gift of Juan Bonifacino. The N-terminal end of the GAT domain, corresponding to amino acids 165-210 and termed NGAT, were amplified and inserted in pEYFP-C1. This was then mutagenized to create the A193T, N194Y mutation.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Encodes a YFP fusion to the N-terminus of the mutated GGA1 NGAT domain. YFP is the monomeric (A207K) version of Citrine, a pH-insensitive YFP variant.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYFP-NGAT(A193T,N194Y) was a gift from Joel Swanson (Addgene plasmid # 11388 ; http://n2t.net/addgene:11388 ; RRID:Addgene_11388)
  • For your References section:

    A Phosphatidylinositol-3-Kinase-Dependent Signal Transition Regulates ARF1 and ARF6 during Fcgamma Receptor-Mediated Phagocytosis. Beemiller P, Hoppe AD, Swanson JA. PLoS Biol. 2006 May 9. 4(6):e162. 10.1371/journal.pbio.0040162 PubMed 16669702