-
Purpose(Empty Backbone) Mammalian (inducible) protein expression, C-terminal 3C-mVenus-Twin-Strep fusion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113891 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR-CMV-TetO2
-
Vector typeLentiviral
-
Selectable markersmVenus
-
Tag
/ Fusion Protein
- 3C-mVenus-Twin-Strep (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNone
- Promoter CMV-MIE-TetO2
-
Tag
/ Fusion Protein
- 3C-mVenus-Twin-Strep (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, AgeI (not destroyed)
- 3′ cloning site KpnI, XhoI (not destroyed)
- 5′ sequencing primer CGTCGTCGTGCTCGTTTAGTG
- 3′ sequencing primer GAACAGCTCCTCGCCCTTGCTCAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This empty backbone contains a 12bp dummy insert.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-CMV-TetO2_3C-mVenus-Twin-Strep was a gift from A. Radu Aricescu (Addgene plasmid # 113891 ; http://n2t.net/addgene:113891 ; RRID:Addgene_113891) -
For your References section:
Lentiviral transduction of mammalian cells for fast, scalable and high-level production of soluble and membrane proteins. Elegheert J, Behiels E, Bishop B, Scott S, Woolley RE, Griffiths SC, Byrne EFX, Chang VT, Stuart DI, Jones EY, Siebold C, Aricescu AR. Nat Protoc. 2018 Nov 19. pii: 10.1038/s41596-018-0075-9. doi: 10.1038/s41596-018-0075-9. 10.1038/s41596-018-0075-9 PubMed 30455477