Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHR-CMV_TetR-HA-NLS-P2A-BSD-Myc
(Plasmid #113899)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 113899 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TetR-HA-NLS-P2A-BSD-Myc
  • Insert Size (bp)
    1203
  • Promoter CMV-MIE
  • Tag / Fusion Protein
    • HA-Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BsiWI (not destroyed)
  • 5′ sequencing primer CGTCGTCGTGCTCGTTTAGTG
  • 3′ sequencing primer CATTAAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-CMV_TetR-HA-NLS-P2A-BSD-Myc was a gift from A. Radu Aricescu (Addgene plasmid # 113899 ; http://n2t.net/addgene:113899 ; RRID:Addgene_113899)
  • For your References section:

    Lentiviral transduction of mammalian cells for fast, scalable and high-level production of soluble and membrane proteins. Elegheert J, Behiels E, Bishop B, Scott S, Woolley RE, Griffiths SC, Byrne EFX, Chang VT, Stuart DI, Jones EY, Siebold C, Aricescu AR. Nat Protoc. 2018 Nov 19. pii: 10.1038/s41596-018-0075-9. doi: 10.1038/s41596-018-0075-9. 10.1038/s41596-018-0075-9 PubMed 30455477