YFP-PBD
(Plasmid #11407)

• Depositing Lab: Joel Swanson
• Depositing Organization: University of Michigan
  Located in United States of America
• Publication: Hoppe et al Mol Biol Cell 2004 Aug;15(8):3509-19. Epub 2004 May 28.
• Citations: 3 Articles

Backbone

• Vector backbone: pEYFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4733
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: p21-activated kinase 1 PBD
• Alt name: PAK1
• Alt name: PBD
• Species: H. sapiens (human)
• Insert Size (bp): 155
• GenBank ID: NM_002576
• Entrez Gene: PAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
• Tag / Fusion Protein:
  • YFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BglII (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GGTGGGAGGTCTATATAAGCAGAGCTGGTT
• 3′ sequencing primer: CCCCGGTGAACAGCTCCTCGCCCTTGCTCA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid encoding the p21-binding domain (PBD) of human PAK1 was a gift from Klaus Hahn.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Encodes PBD with an N-terminal YFP marker. YFP is the Citrine, a pH-insensitive YFP.

DNA (Catalog # 11407-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 11407-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.