CFP-PBD(H83,86L)
(Plasmid
#11402)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 11402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepECFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4733
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep21-activated kinase 1
-
Alt namePAK1
-
Alt namePBD(H83,86L)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)155
-
MutationObtained with Histidine residues 83 and 86 changed to Leucine.
-
GenBank IDNM_002576
-
Entrez GenePAK1 (a.k.a. IDDMSSD, PAKalpha, alpha-PAK, p65-PAK)
-
Tag
/ Fusion Protein
- CFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGTGGGAGGTCTATATAAGCAGAGCTGGTT
- 3′ sequencing primer CCCCGGTGAACAGCTCCTCGCCCTTGCTCA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPlasmid encoding a mutant, Cdc42/Rac-binding deficient p21-binding domain (PBD(LL)) from human PAK1 was a gift from Gary Bokoch.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Encodes PBD(LL) with a N-terminal CFP marker. CFP is the monomeric (A207K) version of ECFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CFP-PBD(H83,86L) was a gift from Joel Swanson (Addgene plasmid # 11402 ; http://n2t.net/addgene:11402 ; RRID:Addgene_11402) -
For your References section:
Cdc42, Rac1, and Rac2 display distinct patterns of activation during phagocytosis. Hoppe AD, Swanson JA. Mol Biol Cell 2004 Aug;15(8):3509-19. Epub 2004 May 28. 10.1091/mbc.e03-11-0847 PubMed 15169870