pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP)
(Plasmid
#114101)
-
Purposefusion protein of Gaussia luciferase variant M23, Volvox channelrhodopsin-1, and enhanced yellow fluorescent protein for bioluminescent optogenetics
-
Depositing Lab
-
Depositing OrganizationCentral Michigan University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114101 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4593
- Total vector size (bp) 6901
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGaussia luciferase, M23; Volvox Channelrhodopsin 1; EYFP
-
Alt nameGLucM23-VChR1-EYFP
-
Alt nameLMO4
-
SpeciesSynthetic
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site AgeI (not destroyed)
- 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 114101 ; http://n2t.net/addgene:114101 ; RRID:Addgene_114101) -
For your References section:
Novel luciferase-opsin combinations for improved luminopsins. Park SY, Song SH, Palmateer B, Pal A, Petersen ED, Shall GP, Welchko RM, Ibata K, Miyawaki A, Augustine GJ, Hochgeschwender U. J Neurosci Res. 2017 Sep 1. doi: 10.1002/jnr.24152. 10.1002/jnr.24152 PubMed 28862809