Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP)
(Plasmid #114101)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114101 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4593
  • Total vector size (bp) 6901
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Gaussia luciferase, M23
  • Alt name
    GLucM23
  • Promoter hSyn

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ACTGAAGGCGCGCTGACGTCACT
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Volvox Channelrhodopsin 1
  • Alt name
    VChR1

Gene/Insert 3

  • Gene/Insert name
    Enhanced Yellow Fluorescent Protein
  • Alt name
    EYFP

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-LMO4 (GLucM23-VChR1-EYFP) was a gift from Ute Hochgeschwender (Addgene plasmid # 114101 ; http://n2t.net/addgene:114101 ; RRID:Addgene_114101)
  • For your References section:

    Novel luciferase-opsin combinations for improved luminopsins. Park SY, Song SH, Palmateer B, Pal A, Petersen ED, Shall GP, Welchko RM, Ibata K, Miyawaki A, Augustine GJ, Hochgeschwender U. J Neurosci Res. 2017 Sep 1. doi: 10.1002/jnr.24152. 10.1002/jnr.24152 PubMed 28862809