pCW-eGFP-FHA-SHLD2-m1
(Plasmid
#114122)
-
PurposeLentiviral vector for inducible expression of N-terminally tagged eGFP-RNF8 FHA domain-SHLD2, m1 mutant; 53BP1-independent recruitment to damaged chromatin
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114122 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerAddgene #41393
- Backbone size w/o insert (bp) 7720
- Total vector size (bp) 11659
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSHLD2 (m1 mutant)
-
Alt nameFAM35A
-
Alt nameRINN2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3939
-
MutationW489A, F494A, W495A mutations introduced
-
Entrez GeneSHLD2 (a.k.a. FAM35A, FAM35A1, RINN2, bA163M19.1)
- Promoter TRE promoter, Tet ON
-
Tags
/ Fusion Proteins
- eGFP (N terminal on insert)
- RNF8 FHA domain (aa 2-160) (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-eGFP-FHA-SHLD2-m1 was a gift from Daniel Durocher (Addgene plasmid # 114122 ; http://n2t.net/addgene:114122 ; RRID:Addgene_114122) -
For your References section:
The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168