Skip to main content

pStA0::crtI
(Plasmid #114343)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114343 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGT400
  • Backbone size w/o insert (bp) 2209
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    crtI (codon optimised)
  • Insert Size (bp)
    1644

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer OligoGT234 GGGGAAACGCCTGGTATCT
  • 3′ sequencing primer OligoGT235 AGCAAAAACAGGAAGGCAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative ID = pGT356 . Please visit https://www.biorxiv.org/content/early/2018/07/04/361626 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pStA0::crtI was a gift from John Heap (Addgene plasmid # 114343 ; http://n2t.net/addgene:114343 ; RRID:Addgene_114343)
  • For your References section:

    Start-Stop Assembly: a functionally scarless DNA assembly system optimized for metabolic engineering. Taylor GM, Mordaka PM, Heap JT. Nucleic Acids Res. 2018 Nov 20. pii: 5193345. doi: 10.1093/nar/gky1182. 10.1093/nar/gky1182 PubMed 30462270
Commonly requested with: