pBEST-HipO
(Plasmid
#114599)
-
PurposeStrong constitutive expression of metabolic enzyme, HipO, for cell-free expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBEST-OR2-OR1-Pr-UTR1-deGFP-T500
-
Modifications to backboneThe gene deGFP was replaced by HipO.
-
Vector typeSynthetic Biology ; Cell-Free Protein Synthesis
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHipO
-
SpeciesCampylobacter jejuni
-
Insert Size (bp)1152
- Promoter OR2-OR1-Pr
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGCTGAGCTAACACCGTGC
- 3′ sequencing primer GGCACCTGTCCTACGAGTTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEST-HipO was a gift from Jerome Bonnet (Addgene plasmid # 114599 ; http://n2t.net/addgene:114599 ; RRID:Addgene_114599) -
For your References section:
Plug-and-play metabolic transducers expand the chemical detection space of cell-free biosensors. Voyvodic PL, Pandi A, Koch M, Conejero I, Valjent E, Courtet P, Renard E, Faulon JL, Bonnet J. Nat Commun. 2019 Apr 12;10(1):1697. doi: 10.1038/s41467-019-09722-9. 10.1038/s41467-019-09722-9 PubMed 30979906